Overexpression of sortilin is associated with 5‐FU resistance and poor prognosis in colorectal cancer

2.1. Reagents

Two human CRC cell lines, WiDr (well‐differentiated adenocarcinoma, stage Dukes C, low grade, microsatellite stable [MSS], v‐Ki‐ras2 Kirsten rat sarcoma viral oncogene homolog (KRAS)^WT, v‐raf murine sarcoma viral oncogene homolog B1 (BRAF)^V600E, phosphoinositide 3‐kinase (PI3KCA)^P449T, phosphatase and tensin homolog (PTEN)^WT) and SW620 (undifferentiated node metastasis, Stage Dukes C, high grade, MSS, KRAS^G12V, BRAF^WT, PI3KCA^WT, PTEN^WT) ²⁸ , ²⁹ were obtained from American Type Culture Collection (ATCC/LGC Promochem, Molsheim, France). Six primary cultures from patients suffering from different stages and grades of CRC, receiving adjuvant 5‐FU‐based chemotherapies, were obtained from IGF (Montpellier France), after informed consent of patients (Material Transfer Agreement CNRS 190287; Table 1). All cells were regularly tested for mycoplasma contamination.

For Western blot analysis, primary antibodies used were mouse anti‐actin (A5441, Sigma‐Aldrich), mouse anti‐ATF3 (MA5‐31635, Thermofisher), rabbit anti‐p75^NTR (sc8317, Santa Cruz), mouse anti‐sortilin (612101, BD Biosciences), mouse anti‐AKT (#2920), rabbit anti‐ERK (#4695), rabbit anti‐PARP (#9542), rabbit anti‐P‐AKT (#4060), rabbit anti‐P‐ERK (#4370), rabbit anti‐α tubulin (#2144) from Cell Signaling Technology and rabbit anti‐TrkB (orb214339, Biorbyt).

For immunohistochemistry analysis, primary antibody used was mouse anti‐sortilin (ANT‐016, Alomone Labs).

For indirect immunofluorescence staining analysis, primary antibody was rabbit anti‐GM130 (PA1‐077, Thermofisher) and mouse anti‐sortilin (612101, BD Biosciences).

2.2. Cell culture and pharmacological treatments

CRC cell lines, WiDr and SW620, were cultured as previously described. ²⁰ The primary cultures were cultured in Dulbecco's modified eagle medium (DMEM) GlutaMAX (supplemented with 10% foetal bovine serum (FBS) and 100 IU/mL penicillin + 100 mg/mL streptomycin (Thermo Fisher, France).

To obtain long‐term 5‐FU‐resistant cells (one month), a modified protocol was followed. ³⁰ In, ³⁰ it took nearby 32 weeks to obtain resistant cells at a final 5‐FU concentration of 2µg/ml. Since the final concentration of 1 µg/mL, corresponding to the IC50 of the cell lines, was chosen, our revisited protocol allowed obtaining resistant cells in only 4 weeks. Cells were seeded in T75 flasks at 5 × 10⁶ cells/10 mL of media (WiDr) or 2.5 × 10⁶ cells/10 mL of media (SW620 and primary cultures) for untreated conditions, and 7 × 10⁶ (WiDr) or 5 × 10⁶ (SW620 and primary cultures) for 5‐FU treatment. During one month, 2 mL of media containing 5‐FU (Sigma‐Aldrich) was added every 72 hours to the cultures in order to reach a final concentration of 8 µmol/L, corresponding to IC50.

2.3. Nude mice xenografts and pharmacological treatment

Animal study was conducted in accordance with guidelines established by the regional Institutional Animal Care and Use Committee (Comité Régional d’Éthique sur l’Expérimentation Animale du Limousin n°87‐005). The same committee also approved the experimental protocol. Ten seven‐week‐old female NMRI Nude mice (Janvier Labs, St. Berthevin, France) were subcutaneously injected with 4 × 10⁶ WiDr or 2 × 10⁶ SW620 cells. Every 3 days, length (L) and width (W) were measured to determine tumour volume (V = [L × W(L + W)]·π/12). Once tumour volume reached 100 mm³ (day 0), mice were divided into two groups, untreated and treated (n = 3 mice per group; dead or unsuccessfully xenografted mice were excluded). Every 3 days for 21 days, mice from the untreated group (CTL) received intraperitoneal injection of 6% dimethyl sulfoxide (DMSO; Sigma‐Aldrich), and mice from the 5‐FU‐treated group (5‐FU) received 40 mg/kg 5‐FU diluted in 6% DMSO. ³¹ At the end of treatment, animals were sacrificed and tumours were recovered for Western blotting and histological analyses.

2.4. Cellular metabolic activity

Cells were seeded in 96‐well plates. The next day, they were exposed to increasing doses of 5‐FU (0, 4, 8, 16, 32 and 64 µmol/L). Seventy‐two hours later, metabolic activity was determined with the thiazolyl blue tetrazolium blue (MTT) assay (CellTiter 96 Aqueous One solution Cell Proliferation Assay, Promega, Charbonnières‐les‐Bains, France) following supplier instructions. Results were expressed as percentage of the value obtained with untreated cells (defined as 100%).

2.5. Cell death and viability

Cell death was evaluated by flow cytometry using PI/Annexin V–fluorescein isothiocyanate (FITC) double staining, as previously described ³² on a FACS Calibur flow cytometer (Becton Dickinson, Heidelberg, Germany). Calibration was performed using untreated cells (control) as reference.

2.6. Cell proliferative activity

After 5‐FU treatments, activated cells were determined by Cell Proliferation ELISA BrdU, colorimetric (Roche, Sigma‐Aldrich) assay. This test is based on the measurement of BrdU incorporation during DNA synthesis in proliferating cells. Untreated cells were used as control (100%).

2.7. Indirect immunofluorescence staining

Fixation, permeabilization/saturation and staining were performed as previously described. ²⁰ Cells were then incubated for 2 hours at room temperature with Alexa Fluor 488 or 594 nm conjugated secondary antibodies (Invitrogen) diluted 1:2500 in phosphate‐buffered saline (PBS); nuclei were then stained with 4',6‐diamidino‐2‐phenylindole (DAPI) for 5 min. Coverslips were mounted in Fluorescence Mounting Medium (Dako Cytomation) and observed by confocal microscopy with a 40× immersion objective using FITC and DAPI lasers (LSM 510 META; Zeiss, Göttingen, Germany). Images were analysed using Zeiss ZEN and ImageJ softwares (NIH, Bethesda, MD, USA).

2.8. Immunohistochemistry staining

Staining of sortilin was performed on tissue microarrays (TMA) of 133 patients (GTX21418 and GTX21433, Clinisciences) and paraffin‐embedded xenografted Nude mice tumours, as previously described. ¹² , ¹⁹ Images were acquired with the Nanozoomer Digital Pathology 2.ORS software. Immunohistochemistry intensity scores were obtained by multiplying the score for staining intensity (0: no staining; 1: weak; 2: moderate; 3: high) with the score for the percentage of positive cells (0: no cells; 1:0‐10%; 2:11‐50%; 3:51‐100%).

2.9. Western blot

Proteins were extracted from whole‐cell lysates (15‐30 µg) and mouse tumour samples (50 µg) as previously described. ²⁰ , ³³ Subcellular fractionation was effected according to supplier instructions (Thermo Fisher, France). Proteins were blotted onto polyvinylidene fluoride membrane (Calbiochem/Merck Millipore) and incubated with primary antibodies. After washing in Tris‐buffered saline/0.1% Tween‐20, immunoreactions were detected as previously described ³⁴ using GeneSnap and GeneTool (Syngene, Cambridge, UK). Densitometric analyses were performed using the ImageJ software.

2.10. Real‐time quantitative polymerase chain reaction (RT‐q‐PCR)

RNA extraction, reverse transcription and real‐time quantitative PCR analyses were performed as previously described. ³⁵ Primers and probe sequences (Life Technologies) were as follows: Hypoxanthine Phosphoribosyltransferase 1 (HPRT1) (Control mix, Applied Biosystems, TaqMan, VIC Catalog number: 4326321E); SORT1 Forward (CTGGGTTTGGCACAATCTTT) and reverse (CACCTTCCTCCTTGGTCAAA). Relative mRNA levels were determined by normalization to HPRT under the reference condition (control defined as 1).

2.11. In silico analysis

SORT1 expression levels by risk group in resected patients suffering from CRC and treated with chemotherapies, according to survival (Sveen Colon ‐ GSE24550), ³⁶ , ³⁷ DFS (Colon Metabase Uniformized dataset ‐ GSE12945), and RFS (Thorsteinsson Olsen Colon ‐ GSE31595) ³⁸ were extracted from SurvExpress‐Biomarker validation for cancer gene expression.

2.12. Statistical analysis

Results were analysed by Kruskal‐Wallis test for immunohistochemistry, and by two‐way ANOVA/ANCOVA for others (StatView 5.0 software; Abacus Concepts, Piscataway, NJ, USA; *P < .05, **P < .01, ***P < .001). Mean and SEM values were obtained from at least three independent experiments; variance being similar between the statistically compared groups. Neither randomization nor blinding was done.

3.1. A 72 hours 5‐FU treatment correlates with sortilin overexpression in CRC cell lines

In previous work, we demonstrated that NTs are survival factors. ¹⁹ , ²⁰ Since 5‐FU responsiveness is only 20‐30%, the possible link between NTs and 5‐FU treatment efficiency was studied in two different CRC cell lines. First, the appropriate 5‐FU concentration for treatment of WiDr and SW620 was determined. WiDr and SW620 were treated with increasing 5‐FU concentrations for 72 hours. As shown in Figure 1A, metabolic activity of the two cell lines decreased with increasing 5‐FU concentrations. A concentration of 8 µmol/L inhibited the metabolic activity of WiDr by 50% (IC50); SW620 cells were less sensitive, displayed 53.9% of their metabolic activity in the same conditions. Because significant difference with control cells was obtained with only 8 µmol/L for SW620, this experimental condition was chosen for further experiments. Moreover, we checked the blockade in the S cell cycle phase for this experimental condition ((P = 0;0003 for WiDr and P = 0,0006 for SW620; Figure 1SA).

As expected, even if apoptotic cells were detected after 5‐FU treatment, living cells represented more than 80% of the population of each one of the cell lines (85,8% for WiDr and 83,7% for SW620; Figure 1B). The difference in 5‐FU sensitivity could be explained by the impact on cell proliferation. Indeed, the proliferation rate of WiDr and SW620 cells dropped by factors of 2.3 and 1.9, respectively, so WiDr presented half the proliferation rate of SW620 (Figure 1SB). These data showed that 72 hours of 5‐FU treatment has a cytostatic effect on the cell lines, WiDr cells being more sensitive than SW620.

In a previous study, we demonstrated the implication of NTs in the survival of CRC cells. ¹⁹ , ²⁰ So, even if we did not see any lethal effect of 5‐FU, we resolved to look after TrkB, p75^NTR and sortilin expression. After 72 hours of 5‐FU treatment, we did not observe any effect on TrkB and p75^NTR expression (Figure 1SC). However, a significant enhancement of sortilin expression was observed in both cell lines (Figure 1C; P = .007 for WiDr and P = .036 for SW620). By examining the main proliferative pathways linked to NTs signalling, the P‐Akt/Akt ratio increased in WiDr (P = 0,016), and significant changes were observed in SW620 (Figure S1D) with a decrease of the P‐Akt/Akt ratio (P = .004) and an increase of the P‐Erk/Erk ratio (P = .0003). However, because the P‐Erk/Erk signalling pathway seemed to increase in the two cell lines after 5‐FU treatment, and more especially in SW620, this result could justify the persistence of the proliferative activity of this latter cell line (Figure 1SB).

3.2. Long‐term (one month) 5‐FU‐resistant cells exhibit sortilin overexpression

This short‐term 5‐FU treatment (72 hours) had cytostatic rather than cytotoxic effects, since the percentage of apoptotic cells failed to vary between control and treated conditions in both cell lines (Figure 1B). So, we resolved to extend the 5‐FU exposure time to one month (8 µmol/L every 72 hours) based on IC50 for WiDr, SW620 and six primary cultures. Even if this prolonged 5‐FU treatment induced an important drop in living cells (85% for WiDr, 88% for SW620 and 72% for primary cultures), it allowed the survival of more than 10% of the cells (Figure 2A). At the end of the treatment, surviving cells were exposed to increasing doses of drug (0 to 64 µmol/L) for 72 hours and were shown do display a strong resistance to 5‐FU. Metabolic activity of these 5‐FU‐resistant cells showed absolutely no sensitivity towards 5‐FU, up to 64 µmol/L, contrary to control cells which had been maintained in drug‐free culture during one month (Figure 2B). This acquired resistance was obtained with the two cell lines and with primary cultures.

As before, we evaluated NTs receptor (TrkB, p75^NTR and sortilin) expression in 5‐FU‐resistant cell issued from the two lines and from primary cultures. Once again, after one month of 5‐FU treatment, only the expression of sortilin was significantly up‐regulated in each cell line (P = .008 for WiDr and P = .004 for SW620; Figure 2C) and in primary cultures as well (P = .002; Figure 2D). Similarly to the data obtained after 72 hours treatments, NTs receptor expression was unchanged (data not shown). Probably due to the low proportion of living cells, proliferative pathways were dramatically affected and were not exploitable (data not shown). Sortilin mRNA levels were also higher in all 5‐FU‐resistant in comparison with control cells (P = .004 for WiDr, P = .013 for SW620 and P = .027 for primary cultures; Figure 2E), suggesting that SORT1 was transcriptionally up‐regulated. Regardless of tumour stage and cellular origin (cell lines or primary cultures), sortilin expression was significantly elevated at both the protein and mRNA levels in 5‐FU‐resistant cells. Consistent with observations obtained with a 72 hours treatment, sortilin seems to behave as a biomarker of 5‐FU resistance in CRC regardless of the duration of the treatment and mutational status as well.

3.3. 5‐FU disrupts sortilin localization and transcriptional regulation

Because 5‐FU interferes with numerous cellular processes notably implicated in cytoskeleton organization and function ³⁹ and because sortilin is a key protein implicated in intracellular trafficking, ⁴⁰ its localization was evaluated in 5‐FU‐resistant cells (WiDr, SW620 and primary cultures). After 5‐FU long‐term treatment (one month), sortilin was found to be accumulated in membranes and in the cytoskeleton, contrary to control cells (Figure 3A). Moreover, sortilin localization is restricted to the Golgi as shown by its co‐localization with GM130, a Golgi marker (Figure 3B) which is more easily seen in SW620. Furthermore, transcriptomic regulation of sortilin expression was analysed in WiDr and SW620. Since it has been demonstrated that ATF3 is able to bind the SORT1 promoter and repress SORT1 transcription, ⁴¹ ATF3 expression was assessed in cytoplasm and nucleus of the treated cells (Figure 3C). Our data showed that ATF3 expression strongly dropped after 5‐FU long‐term treatment, especially in nuclei where it exercises its transcriptional activity. So, the virtual disappearance of ATF3 could explain the observed overexpression of sortilin after 5‐FU‐prolonged treatment.

3.4. 5‐FU treatment increases sortilin expression in tumours from Nude mice xenografted with CRC cell lines

In order to explore the correlation between sortilin expression and the responsiveness of tumours to 5‐FU, WiDr and SW620 were grafted into Nude mice. Once tumour volumes reached 100 mm³ (day 10 for WiDr and day 17 for SW620), mice were treated (Treatment Initiation, T. I.) with 5‐FU or vehicle (CTL) every 72 hours until sacrifice (day 28, ie one month). WiDr‐derived tumours regressed significantly relative to control after 15 days of 5‐FU treatment (Figure 4A). Despite the evident sensitivity of these tumours to 5‐FU, the regimen was not sufficient to induce total tumour regression, suggesting that a 5‐FU‐resistant subpopulation of cells survived the treatment. By contrast, SW620‐derived tumours were totally resistant to 5‐FU and did not regress at all (Figure 4A). Moreover, 5‐FU‐treated tumours from both WiDr and SW620 expressed elevated levels of the sortilin protein (Figure 4B,C) contrary to other NTs expressions (data not shown). In vivo, even though cells from low‐grade tumours (WiDr) responded better to 5‐FU than those derived from high grade tumours (SW620), sortilin protein expression was significantly higher in either one of the persistent tumours following 5‐FU treatment. These in vivo data are in complete agreement with the results obtained in vitro highlighting the role of sortilin as a marker of 5‐FU resistance.

3.5. SORT1 mRNA expression is associated with poor clinical outcomes and sortilin expression is positively correlated with CRC grades

Finally, once demonstrated the link between 5‐FU resistance and sortilin, we assessed its expression level in relation with prognosis of CRC. Thus, we checked the expression of SORT1 mRNA in relation with patient status. The in silico analysis of data bases showed that SORT1 mRNA expression levels were significantly elevated in high‐risk patient groups characterized by the worst survival, disease‐free survival (DFS) and relapse‐free survival (RFS), who are at the highest risk of developing new tumours after treatments (Figure 5A‐C). Moreover, ex vivo quantification of sortilin in tissues from 133 patients with benign (n = 7) or colorectal tumours from three tumour grades (n = 8, 98, and 20 for I, II, and III, respectively) revealed a positive correlation of sortilin protein expression with tumour grade (Figure 5D) while a simple upward trend was observed for CRC stages (data not shown). These observations have to be put together with those obtained in vitro: the sortilin level of the WiDr cell line, a reference for low tumour grade, was significantly lower than the level found in the SW620 cell line, a reference for high tumour grade (Figure 5E and Figure 1C). These findings about sortilin expression in various environments indicated that not only is sortilin a 5‐FU resistance marker but also a biomarker for CRC aggressiveness associated with poor clinical outcomes.